Even complicated and confusing topics will be easily developed and covered if you request our help writing an essay. Place an order today!

Transcription/Translation: Consider the gene below:

3′ 123456789101112131415161718192021 5′

TACCCTTAACCAATGAGTATT

5′

ATGGGAATTGGTTACTCATAA 3′

1.In the space below, write the nucleotide sequence for the mRNA encoded by the gene. Be sure to indicate the 3′ and 5′ ends for the mRNA.

2.Circle the translation start codon in the mRNA above.

3.What is the nucleotide sequence in the anti-codon loop of tRNA that is complementary to the start codon? ______. Indicate the 3′ and 5′ side of the anti-codon region.

4.What amino acid does the start codon specify? ________

5.Circle the translation stop codon in the mRNA strand above.

6.Using a codon table (see table in your text), in the space below write the predicted sequence of amino acids for the polypeptide encoded by this gene.

 

"Is this question part of your assignment? We Can Help!"

testimonials icon
I have an assignment on Political Science and I need some help please...
testimonials icon
Running head: BEST PRACTICE IN SALES ANALYTICSBest Practice in Sales AnalyticsStudents NameInstitutional AffiliationsDate1BEST PRACTICE IN SALES ANAL...
testimonials icon
Assignment 2 Grading Criteria; Please use templant providedMaximum Points...
testimonials icon
Considering Tradeoffs You Make Every Day Let’s talk about two tradeoffs we face every day: how we spend our time and money....
testimonials icon
Business ConsultantsAddressDateNew Hampshire Business Products1050 Industry WayConcord NH 03301Dear Mary Jones,RE: REVIEW OF CURRENT BUSINESS OPERATI...
testimonials icon
  PROF washington watson  ...
testimonials icon
Assignment Conten Complete the Week Two Financial Exercises worksheet. Hcs/385 week...
testimonials icon
As part of a marketing research committee for your organization, you have been assigned the task of preparing a 700-word research paper about curre...
testimonials icon
 Tympanic Membrane and Thyroid GlandUsing the South University Online Library or the Internet, research t...
testimonials icon
 Effective  financial reporting depends on sound ethical behavior. Financial  scandals in accounting and the businesses world have result...

Other samples, services and questions:

Calculate Price

When you use PaperHelp, you save one valuable — TIME

You can spend it for more important things than paper writing.

Approx. price
$65
Order a paper. Study better. Sleep tight. Calculate Price!
Created with Sketch.
Calculate Price
Approx. price
$65